Ein Kapitel zurück Ein Kapitel vor

2             Material und Methoden

2.1       Material

2.1.1     Geräte

 

Kühlzentrifuge Megafuge 1,0R mit Rotor BS 4402/A, Brutschrank 5050E, Fa. Haereus-Christ, Osterode; Kühlzentrifuge Sorvall RC5B mit Rotor GS-3 Fa. Du Pont; Eppendorf Centrifuge 5415, Eppendorf Thermomixer 5436, Eppendorf Thermostat 5320, Eppendorf Photometer 1101M, Fa. Netheler und Hinz Hamburg; Tischzentrifuge Rotana/S, Fa. Hettich, Tuttlingen; Schüttelinkubator, Fa. New Brunswick Scientific Co., New Brunswick, N.J. (USA); Schüttelinkubator Lab-Shaker mit Thermostat Lab-Therm, Fa. B. Braun, Melsungen; Schüttelwasserbad GFL 1083, Fa. AD Krauth, Hamburg; Waage PC 4400, Fa. Mettler GmbH Gießen; Feinwaage Sartorius 2432, Fa. Leitz Wetzlar; Sofortbildkamera MP-4 Land-Camera Modell 44-32, Sofortbildfilme 665 und 667, Fa. Polaroid Co., Cambridge, Ma. (USA); Chromato VUE-Transluminator C-61, Fa. Vetter K.G.; Digital-pH-Meter 646, Fa. Knick, Berlin; Gelkammern, Fa. Regina v. Keutz Laborgeräte; Electrophoresis constant power supply, Fa. Pharmacia; ABI Prism 310; Phero-stab. 500, Fa. Biotec-Fischer; Röntgenfilme X-Omat AR, Fa. Kodak; Röntgenfilme, Fa. Agfa; Zeta-Probe Nylon Blotting Membranes, Fa. Bio-Rad, Richmond (USA); Sterilfilter 0,2 µm Porengröße, Fa. Sartorius, Göttingen; Thermocycler, Fa. Perkin Elmer, Norwalk (USA); Thermocycler Primus 96 plus; Fa. MWG Biotech;

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.2     Chemikalien

 

Borsäure z.A., Calciumchlorid2-hydrat krist. z.A., Chloroform z.A., D(+)-Glucose wasserfrei, di-Natriumhydrogenphosphat2-hydrat z.A., Dodecylsulfat Natriumsalz, Ethidiumbromid, Isoamylalkohol z.A., Natriumchlorid z.A., Natriumdihydrogenphosphat-Monohydrat z.A., Natriumhydroxid z.A., Pufferlösung pH 5,00, Pufferlösung pH 7,00, Pufferlösung pH 9,00, Salzsäure rauchend 37 % reinst, Titriplex III z.A., Firma Merck, Darmstadt

Natriumacetat 99 % z.A., Rotiphorese Sequenziergel Konzentrat, Rotiphorese Sequenziergel Puffer Konzentrat, Rotiphorese Sequenziergel Verdünner, Rotipuran Essigsäure 100 % p.a., Firma Roth

Lambda DNA-HindIII Digest, plusone Repel-Silane ES, plusone Bind-Silane, One-Phor-All-buffer, Firma Pharmacia Biotech

Calciumchlorid, Fa. Sigma, München

Glycine analytical grade, Tris(hydroximethyl)aminomethane, Firma Serva

GLASSMILK®, Natriumiodidlösung, New Wash Concentrate, TBE-Modifier®, Fa. BIO 101, Vista (Canada)

ddATP, ddCTP, ddGTP, ddTTP, 7-deaza-dGTP, Dithiothreitol 0,1M, Labeling Mix, Fa. SequenaseTM buffer, Sequenase dilution buffer, Fa. Amersham, Cleveland (USA)

Termination Ready Reaction Mix, Template supression reagents, Fa. PE Applied Biosystems, Foster City (USA)

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.3     Enzyme

 

alkalische Phosphatase, RNase, DNase-free, Firma Boehringer, Mannheim;

Restriktionsendonucleasen AvaI, EcoRI, HindIII, SalI und XbaI, Fa. Pharmacia Biotech

SequenaseTM Version 2.0, Fa. Amersham, Cleveland (USA)

AmpliTaq ® DNA Polymerase, Fa PE applied Biosystems, Fa. Foster City (USA)

T4 DNA-Ligase, Fa. Boehringer Mannheim.

Lysostaphin, Fa. Sigma, München

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.4     Oligonucleotide

 

5L                   CTCACAATAGAGAGATGTCACCG

3R                   GGCCTTGAAACATTGGTTTAGTGGG

M13reverse     GGAAACAGCTATGACCATG

M13-20           GTAAAACGACGGCCAGT

JKMK1           GTGGAAGAATTTAAGCAACA

JKMK2           GGAATATCTGTTTTTAAGCAT

JKMK3           GCCAAACTTTATCATACTCAT

JKMK4           CTGAGCAAATTAACCAATGG

JKMK5           TAACTTTGTCCCATTTCCAT

JKMK6           TGAAGTCGTGATACATGCAT

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.5     Nährmedien

 

Purple-Agar Base, Bacto-Agar, Bacto-Peptone, Tryptic soy broth (TSBDifco), Fa. Difco Laboratories, Detroit (USA);

Tryptone, Tryptone soya broth (TSBOxoid), Fa. OXOID Ltd., Basingstoke (England);

Trypticase soy broth (TSBBBL), Fa. Becton Dickinson and Company, Cockeysville (USA);

 

Selbsthergestellte Medien:

LB-Brühe:                               10g Tryptone

            5g Hefeextrakt

            10g NaCl

            auf 1000 ml aufgefüllt (pH 7,5)

 

TSB-Medium ohne Glucose:    17 g Tryptone

            3 g Peptone

            5 g NaCl

            2,5 g K2HPO4

            auf 1000 ml aufgefüllt (pH 7,3)

 

PY-Brühe:                               10g Peptone

            5g Hefeextrakt

            5g NaCl

            1g Glucose

            auf 1000 ml aufgefüllt (pH 7,0)

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.6     Organismen

 

Wildtypstämme:

 S. epidermidis 1457

S. epidermidis RP62A

S. epidermidis ZK 1815

S. epidermidis SE 5

S. epidermidis BK 521

S. epidermidis BK 1057

S. epidermidis BK 939

S. epidermidis BK 1535

S. epidermidis BK 10333

S. epidermidis BK 5179

S. epidermidis BK 7837

S. epidermidis BK 9225

S. epidermidis BK 9896

 

Transposonmutanten:

S. epidermidis 1457-M10

 S. epidermidis 1457-M12

 S. epidermidis 1457-M13

S. epidermidis 1457-M15

S. epidermidis 1457-M16

S. epidermidis 1457-M17

S. epidermidis 1457-M19

S. epidermidis 1457-M20

S. epidermidis 1457-M24

 

E. coli Laborstämme:

E. coli DH5a

E. coli MC1061

E. coli TOP10

 

Klinische S. aureus-Isolate:

S. aureus VA 35005

S. aureus VA 35043

 

Klone von Transposonmutanten DNA in Escherichia coli:

E. coli MC1061JK30.28 mit Plasmid pSKJK30.28 (M20)

E. coli MC1061JK30.29 mit Plasmid pSKJK30.29 (M20)

E. coli MC1061JK30.30 mit Plasmid pSKJK30.30 (M20)

E. coli MC1061JK74.3 mit Plasmid pSKJK74.3 (M12)

E. coli MC1061JK74.9 mit Plasmid pSKJK74.9 (M12)

E. coli MC1061JK74.9 mit Plasmid pSKJK74.24 (M12)

E. coli MC1061JK186.19 mit Plasmid pSKJK186.19 (M16)

E. coli MC1061JK186.20 mit Plasmid pSKJK186.20 (M16)

E. coli MC1061JK186.21 mit Plasmid pSKJK186.22 (M16)

E. coli MC1061JK186.34 mit Plasmid pSKJK186.34 (M15)

E. coli MC1061JK186.35 mit Plasmid pSKJK186.35 (M15)

E. coli MC1061JK186.36 mit Plasmid pSKJK186.36 (M15)

E. coli MC1061JK186.41 mit Plasmid pSKJK186.41 (M15)

E. coli MC1061JK186.42 mit Plasmid pSKJK186.42 (M15)

E. coli MC1061JK186.44 mit Plasmid pSKJK186.44 (M15)

E. coli MC1061JK186.46 mit Plasmid pSKJK186.46 (M19)

E. coli MC1061JK186.47 mit Plasmid pSKJK186.47 (M19)

E. coli MC1061JK186.48 mit Plasmid pSKJK186.48 (M19)

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.1.7     Datenbanken und Programme

 

Deutsches Krebsforschungszentrum Heidelberg:

Heidelberg Unix Sequence Analysis Resources (HUSAR)

Adresse: genius.embnet.dkfz-heidelberg.de

Programme:     Seqed

Translate

Map

Mapsort

Bestfit

Pepdata

Publish

 

National Center for Biotechnology Information, Bethesda USA:

BLAST E-Mail Server

Adresse: blast@ncbi.nlm.nih.gov

Programme:     BLASTN

            BLASTP

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2       Methoden

2.2.1     Biofilmtestung

 

Referenz:          Christensen et al., 1985; Baldassarri et al. 1993

 

Lösungen:        TSB ohne Glucose

TSB-Medien (BBL, Difco, Oxoid)

PBS-Puffer

Gentiana-Violett

 

Eine Kolonie einer frischen Übernachtkultur des zu untersuchenden Stamms auf Blutagar wurde in 2 ml TSB ohne Glucose verimpft und für 5 bis 6 h bei 37 °C im Schüttelinkubator kultiviert. Von dieser Vorkultur wurden 20 µl in 2 ml der jeweilig verwendeten TSB-Medien suspendiert. Den Medien für die Hauptkultur wurde bei Bedarf NaCl bzw. Ethanol zugesetzt. In eine 96-Loch-Zellkulturplatte wurde in vier Vertiefungen je 200 µl der Hauptkultur verimpft und bei 37 °C im Brutschrank für 20 bis 22 h inkubiert. Die Platte wurde anschließend kräftig ausgeschlagen und jede Vertiefung viermal mit PBS-Puffer gespült und erneut kräftig ausgeschlagen. Die Platte wurden entweder über Nacht bei Raumtemperatur oder bei 37 °C im Brutschrank für 4 h getrocknet. In die Vertiefungen der getrockneten Platte wurden je 50 µl Gentianaviolettlösung pipettiert und für 5 min zum Anfärben des Biofilms belassen. Nach kräftigem Spülen der Platte wurde diese erneut kräftig ausgeschlagen und luftgetrocknet.

 

Zur Auswertung des Biofilmtests wurden die Intensität der Färbung in einem BEPII-Photometer bei einer Wellenlänge von 570 nm, bei einer Referenzwellenlänge von 405 nm im evaluation mode 3 gemessen. Eine Extinktion von größer oder gleich 0,1 wurde als biofilmpositiv gewertet.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.2     Präparation chromosomaler DNA von S. epidermidis

 

Referenz: Mack et al. 1994b

 

Lösungen:        NaCl-Puffer:    2,5 M NaCl

50 mM Tris

50 mM EDTA, pH 7,0

7 % SDS

Chloropan:       Chloroform/Isoamylalkohol 24:1

TE-Puffer:        10 mM Tris-HCl

1 mM EDTA, pH 8,0

                        3M Na-Acetat, pH 7,0

96 % Ethanol

 

In 10 ml PY-Brühe + 1 % Glycerin wurden die Stämme als Vorkultur bei 37 °C im Schüttelinkubator über Nacht (ca. 16h) angezüchtet. Von der Vorkultur wurden 4 ml in 400 ml PY-Brühe + 1 % Glycerin verimpft und 24 h bei 37 °C im Schüttelinkubator kultiviert. Die Zellen wurden für 15 min bei 6000 rpm in der Sorvall-Zentrifuge mit GS-3 Rotor zentrifugiert und das Zellpellet in 3 ml NaCl-Puffer resuspendiert. Nach Zugabe von 100 µl Lysostaphin (1500 U/ml) und 2,5 µl RNAse (0,5 mg/ml; Fa. Boehringer) wurden die Proben so lange bei 37 °C im Wasserbad inkubiert bis die Zellyse durch deutliche Schlierenbildung erkennbar wurde (ca. 3 h). Dem Zellysat wurde 3 ml 7 % SDS zugegeben und die Probe für 30 min auf Eis inkubiert.

 

Nach der Inkubation auf Eis wurden 7 ml Chloropan zugegeben und die Probe kurz gevortext. Die Probe wurde dann 2 h bei Raumtemperatur stehen gelassen bis eine deutliche Trennung in drei Phasen sichtbar wurde. Nach Zentifugation für 30 min bei 4000 rpm in der Megafuge 1,0R bei Raumtemperatur wurde die obere wäßrige Phase in ein neues Falcon-Tube überführt und mit 0,1 Vol. einer 3 M Na-Acetat Lösung versetzt. Es wurde anschließend mit 2 Volumen 96 % Ethanol überschichtet. Mit einer durch Anschmelzen an der Spitze gebogenen Pasteurpipette wurde die an der Interphase ausfallende DNA aufgewickelt, kurz luftgetrocknet und in 500 µl TE-Puffer überführt. Der Aufwickelvorgang wurde so lange wiederholt bis keine DNA mehr an der Interphase ausfiel.

 

Vor der Weiterverarbeitung wurde die DNA entweder bei 37 °C für eine Stunde, oder bei 4 °C über Nacht vollständig gelöst. Die DNA konnte für Monate bei 4 °C aufbewahrt werden.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.3     Präparation von Plasmid-DNA aus E. coli

 

Referenz:          Birnboim und Doly, 1979

 

Lösungen:        Doly I:             50 mM Glucose

25 mM Tris Cl (pH 8,0)

10 mM EDTA (pH 8,0)

Doly II:            0,2 N NaOH

1 % SDS

Doly III:           3 M Kalium

5 M Acetat

TE-Puffer:        10 mM Tris-HCl

1 mM EDTA, pH 8,0

 

In 10 ml LB-Medium, mit einem zur Selektion geeigneten Antibiotikum, wurde eine Kolonie des plasmidtragenden E. coli-Stamms verimpft und bei 37 °C im Schüttelinkubator über Nacht kultiviert. 1,5 ml der Bakterienkultur wurden in einem Eppendorfhütchen 1 min mit 12000 rpm bei Raumtemperatur zentrifugiert und das Pellet in 100 µl eiskalter Doly I Lösung resuspendiert. Alle weitere Schritte wurden auf Eis ausgeführt. Der Probe wurden 200µl raumtemperierter Doly II Lösung zugegeben und durch fünffaches Schwenken vorsichtig gemischt. Nach Zugabe von 150 µl eiskalter Doly III Lösung wurde die Probe 10 sec. gevortext und für 5 min auf Eis gestellt. Anschließend wurde die Probe 5 min mit 12000 rpm bei 4 °C in der Eppendorfzentrifuge zentrifugiert.

 

In ein neues Eppendorfhütchen wurden je 200 µl Phenol und 200µl Chloropan gegeben und der entstandene Überstand zupipettiert. Nach kurzem Vortexen wurde die Probe erneut 5 min mit 12000 rpm bei 4 °C in der Eppendorfzentifuge zentrifugiert. Der wäßrige Überstand wurde in ein Eppendorfhütchen überführt. Als weiterer Reinigungsschritt wurde 400 µl Chloropan zugefügt und nach kurzem Vortexen erneut für 3 min mit 12000 rpm bei 4 °C zentrifugiert. Der wäßrige Überstand wurde in ein neues Eppendorfhütchen überführt.

 

Die DNA wurde durch Zugabe von 2 Vol. 96 % Ethanol für 2 min bei Raumtemperatur gefällt und mittels Zentrifugation mit 12000 rpm bei 4 °C pelletiert. Das DNA-Pellet wurde in 1 ml 80 % Ethanol gewaschen und anschließend luftgetrocknet. Die DNA wurde in 28 µl TE-Puffer und 2 µl RNase für 30 min bei 37 °C gelöst und bei –20 °C bis zur Weiterverarbeitung gelagert.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.4     Restriktionsenzymverdau von Plasmid- und chromosomaler DNA

 

Referenz:          Sambrook et al., 1989, Herstellerangaben

 

Für Restriktionsspaltungen wurden 0,5 bis 1 µg DNA und 2 U des entsprechenden Enzyms in einem Gesamtansatzvolumen von 20 µl eingesetzt. Die Menge des verwendeten One-Phor-All-Puffer richtete sich nach den von den Herstellern empfohlenen Richtlinien. Bei Spaltungen mit unterschiedlichen optimalen Pufferanteilen für zwei oder mehrere Enzyme wurde nacheinander gespalten. Zuerst wurde mit dem Enzym mit der niedrigsten, benötigten Pufferkonzentration gespalten. Nach Inaktivierung des Enzyms wurde erneut Puffer zugegeben und mit dem bzw. den weiteren Enzymen gespalten. Für alle verwendeten Enzyme war eine Inkubationstemperatur von 37 °C nötig. Der Reaktionsansatz wurde für 1 h inkubiert. Das Enzym wurde bei 65 °C für 15 min inaktiviert bzw. die DNA mit Phenol gereinigt. Die vollständige Spaltung wurde durch Gelelektrophorese in 0,7 % Agarosegelen kontrolliert.

 

Für präparative Ansätze wurde die DNA bis zur 30fachen Menge bei 10fachem Gesamtansatzvolumen erhöht.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.5     DNA-Fragmentauftrennung durch Agarose-Gelelektrophorese

 

Lösungen:        Stopmix:          0,25 % Bromphenolblau

0,25 % Xylen Cyanol FF

15 % Ficoll

                        TBE-Puffer:     90 mM Tris

90 mM Borsäure

2,5 mM EDTA, pH 8,0

                        1 % Ethidiumbromid

                        DNA-Marker: HindIII gespaltene l-Phagen DNA

 

0,7 % SeaKem-Agarose wurde durch Kochen in TBE Puffer gelöst. Der gelösten Agarose wurde pro 40 ml Lösung 1 µl 1 % Ethidiumbromid zugefügt. Die Agaroselösung wurde in eine Horizontalgelkammer gegossen und bis zur Erstarrung abgekühlt. Nach der Verfestigung des Gels wurde die Gelkammer mit TBE-Puffer gefüllt, so daß das Gel mit ca. 1 mm Puffer bedeckt war. Die zu untersuchenden DNA-Proben wurden in einem Gesamtvolumen von 20 µl mit 3 µl Stopmix versetzt und in die entsprechenden Probenplätze gefüllt. Die Elektrophorese wurde bei einer Feldstärke von 5 V/cm für vier Stunden bzw. 1 V/cm über Nacht durchgeführt. Das Gel wurde auf einem UV-Transilluminator mit einer Sofortbildkamera fotogafiert.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.6     DNA Aufreinigung aus Agarosegelen

 

Referenz:          Vogelstein und Gillespie, 1979; Herstellerangaben

 

Lösungen:        3M NaI

TBE-Modifier

GLASSMILK

NEW WASH-Lösung

TE-Puffer:        10 mM Tris-HCl

1 mM EDTA, pH 8,0

 

Zur Aufreinigung von DNA aus Agarosegelen wurde Geneclean®II der Firma BIO 101 verwendet. Die gewünschte DNA wurde mit einem sauberen Skalpell unter UV-Licht aus dem mit Ethidiumbromid gefärbten Agarosegel ausgeschnitten und auf einer Feinwaage gewogen. Der Agaroseblock wurde kleingeschnitten und je nach Größe in ein Eppendorfhütchen oder ein Falcontube gegeben.Es wurde ein halbes Volumen von TBE-Modifier und das 4,5fache Volumen einer 3M-NaI-Lösung zugegeben. Dieses Gemisch wurde bis zur vollständigen Auflösung des Agarosegels bei 55 °C im Wasserbad inkubiert.

 

Es wurden 5 µl der gut resuspendierten Glasmilch hinzugefügt und kurz gevortext. Die Suspension wurde zur Bindung der DNA an die Glaspartikel 5 min auf Eis inkubiert. Für eine ausreichende Ausbeute an DNA mußten alle weiteren Schritte auf Eis bzw. bei 4 °C durchgeführt werden.

 

Das Falcontube wurde 3 min mit 4000 rpm in der Megafuge 1,0R bei 4 °C bzw. das Eppendorfhütchen 2 min mit 12000 rpm in der Eppendorfzentrifuge bei 4 °C zentrifugiert und das Pellet in 400 µl NEW WASH-Lösung resuspendiert. Die Suspension im Falcontube wurde in ein Eppendorfhütchen überführt. Nach kurzer Zentrifugation von wenigen Sekunden in einer Eppendorfzentrifuge bei 12000 rpm und 4 °C wurde das Pellet erneut zweimal in NEW WASH-Lösung gewaschen. Nach dem letzten Waschschritt wurde erneut für wenige Sekunden zentrifugiert und der Überstand sauber abpipettiert.

 

Das Pellet wurde in 10 bis 30 µl TE-Puffer resuspendiert und bei 55 °C im Wasserbad zur Ablösung der DNA von den Glaspartikeln für 3 min inkubiert. Nach erneuter Zentrifugation in einer Eppendorfzentrifuge mit 15000 rpm bei Raumtemperatur wurde der Überstand abpipettiert und in ein neues Eppendorfhütchen überführt. Die DNA konnte bei -20 °C über längere Zeit gelagert werden.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.7     Ligationsreaktionen in Vektor pBluescript® II SK und TOPO-Vektor

 

Referenz: Alting-Mees und Short, 1989; Herstellerangaben

 

Zur Vorbereitung für die Ligationsreaktion wurde 1 µg aus E. coli präparierter Vektor pBluescript® II SK mit 2 U von einem bzw. zwei in der „multiple cloning site“ spaltenden Restriktionsenzymen in einem Gesamtreaktionsvolumen von 10 µl für 1 h bei 37 °C inkubiert. Der nur durch ein Enzym gespaltene Vektor wurde anschließend an den freiliegenden 5´-Enden durch Behandlung mit Alkalischer Phosphatase dephosphoriliert. Dazu wurde 1 µl des gespaltene Vektors zur Kontrolle abgenommen und 2 µl Alkalische Phosphatase-Puffer und 1 µl Alkalische Phosphatase zugegeben und erneut für 1 h bei 37 °C inkubiert.

 

Vor der Ligation wurden alle Enzyme durch Inkubation bei 65 °C für 15 min inaktiviert und der Reaktionsansatz 1:10 verdünnt. Für die Ligation wurden 1 µl des verdünnten Vektors mit der mit entsprechenden Restriktionsenzymen gespaltenen und aufgereinigten DNA in den Verhältnissen 1:4, 1:1 und 4:1 in einem Gesamtreaktionsansatz von 10 µl bei 16 °C für 16 bis 22 h inkubiert. Je 5 µl des Ligationsansatzes wurden auf kompetente E. coli MC1061 transformiert.

 

Zur Ligation von PCR-Amplifikaten wurden 1 µl aus einem Agarosegel gereinigten Amplifikats mit 3 µl Aqua dest und 1 µl TOPO-Vektor bei Raumtemperatur für 5 min inkubiert. Der komplette Ligationsansatz wurde in kompetente E. coli TOP10 transformiert.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.8     Plasmidtransformation in E. coli

 

Referenzen:      Cohen 1972; Dagert und Ehrlich, 1979

 

Lösung:            50 mM CaCl2-Lösung

 

In 50 ml LB-Medium wurde eine Kolonie E. coli MC1061 inokuliert und bei 37 °C im Schüttelinkubator kultiviert. Die Wachstumsphase wurde im Eppendorf Photometer 101M kontrolliert und die Zellsuspension bei einer OD578 von 0,2 bis 0,5 (optimal 0,3 bis 0,4) in einem Falcon-Tube für 10 min auf Eis gestellt. Die Zellen wurden in der Megafuge 1,0R mit 4000 rpm bei 4 °C für 10 min zentrifugiert. Das Zellpellet wurde in 10 ml eiskalter 50 mM CaCl2-Lösung resuspendiert und für 45 min auf Eis gestellt. Anschließend wurden die Zellen erneut mit 4000 rpm bei 4 °C für 10 min pelletiert und das Pellet in 2 ml eiskalter 50 mM CaCl2-Lösung resuspendiert. Bis zur Weiterverarbeitung wurden die kompetenten Zellen für maximal 24 h bei 4 °C aufbewahrt.

 

100 µl kompetenter E. coli wurden mit 5 µl der zu transformierenden DNA auf Eis in einem Reagenzglas versetzt und für 75 s bei exakt 42 °C im Wasserbad inkubiert und anschließend sofort wieder für 10 min auf Eis gestellt. Nach Zugabe von 400 µl LB-Medium wurden die Zellen zur Regeneration für 1 h im Schüttelinkubator bei 37 °C inkubiert. Je 100 bzw. 125 µl der Zellsuspension wurden auf LB-Agarplatten mit entsprechenden Antibiotika zur Selektion ausplattiert und bei 37 °C im Brutschrank über Nacht kultiviert.

 

Für die Transformation von in TOPO-Vektor ligierten PCR-Amplifikaten wurde der mitgelieferte kompetente E. coli TOP10 mit einem ähnlichen Transformationsprotokoll verwendet. Einziger Unterschied war das Regenerationsmedium. Hier wurde das mitgelieferte SOC-Medium an Stelle des LB-Mediums verwendet.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.9     DNA-Blotting mit Posiblotter

 

Lösungen:        0,25 M HCl-Lösung

0,5 M NaOH-Lösung

2xSSC:            300 mM NaCl

            30mM NaCitrat (pH 7,5)

 

Für das Blotten von Agarosegelen auf Nitrocellulosemembranen mittels Überdruck mußte die DNA im Gel zuerst für 15 min in 0,25 M HCl depuriniert werden. Anschließend wurde die DNA für mindestens 1 h in 0,5 M NaOH denaturiert. Nach dem Denaturierungsschritt wurden die Geltaschen sorgfältig leerpipetiert und mit 2 %iger Agarose verklebt, um einen Luftdurchtritt zu vermeiden. In der Druckkammer des Posi-Blot-Gerätes wurden drei NaOH getränkte Filterpapier so aufgebracht, daß die Öffnung der Kunststoffmaske an allen Seite um ca. 1 cm überragt wurde. Entstandene Luftblasen wurden durch Festrollen der Filterpapiere mit einer Glaspipette entfernt. Auf die Filterpapiere wurde dann blasenfrei eine in NaOH gesättigte Nitrocellulosemebran aufgebracht und anschließend die Kunststoffmaske aufgelegt, so daß die Mebran ca. 0,5 bis 1 cm an allen Seite überstand. Das Agarosegel wurde auf die Maske so aufgebracht, daß diese ebenfalls an allen Seiten überragt wurde, um einen luftdichten Verschluß zu gewährleisten. Auf das Gel wurden drei NaOH-gesättigte Filterpapiere der gleichen Größe blasenfrei aufgebracht und anschließend wurde ein mit NaOH getränkter Schwamm aufgelegt.

 

Die Druckkammer wurde sorgfältig verschlossen und der angeschlossene Kompressor wurde auf einen Druck von 75 mm Hg äquilibriert. Das Gel wurde für 1 h bei diesem Druck auf die Membran geblottet. Anschließend wurde die Membran kurz in 2xSSC gewaschen und die DNA bei 80 °C für 1 h fixiert.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.10     DNA-Blotting

 

Lösungen:        0,5 M NaOH

2xSSC:            300 mM NaCl

            30mM NaCitrat (pH 7,5)

Für den Transfer von DNA auf Nitrozellulosemembranen durch Kapillarkraft wurde zwischen zwei mit 0,5 M NaOH gefüllte Plastikschalen eine Glasscheibe gelegt, auf die überlappend Filterpapiere aufgelegt wurden. Das Agarosegel wurde blasenfrei auf die Filterpapiere aufgelegt und die Nitrocellulosemembran wurde vorsichtig mit einer Glaspipette aufgerollt. Um das Gel wurde eine Maske aus Zellophanfolie gelegt, um einen seitlichen Übertritt der NaOH-Lösung zu vehindern. Auf die Membran wurde NaOH getränktes Filterpapier und anschließend viellagig Zellstoff aufgelegt. Der Versuchsaufbau wurde mit einer Glasscheibe beschwert und für 16 h stehen gelassen. Anschließend wurde die Membran kurz in 2xSSC gewaschen und die DNA bei 80 °C fixiert.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.11     Radioaktive Hybridisierung

 

Lösungen:        TE-Puffer:                               10 mM Tris-HCl

1 mM EDTA, pH 8,0

            Hybridisierungslösung: 0,1 mM EDTA

150 mM NaH2PO4

            350 mM Na2HPO4

            2,5 % SDS

            WashI-Lösung:                        0,1 mM EDTA

12,5 mM NaH2PO4

80 mM Na2HPO4

1,25 % SDS

 

            WashII-Lösung:                       0,1 mM EDTA

12,5 mM NaH2PO4

80 mM Na2HPO4

0,05 % SDS

 

Für die radioaktive Markierung der Sonden wurden 25 bis 50 ng der DNA in einem Endvolumen von 45 µl TE-Puffer für 15 min bei 95 °C denaturiert. Die denaturierte DNA wurde auf das lyophilisierte Ready-To-Go Kit pipettiert, welches die benötigten Nukleotide und Enzyme enthielt. Nach sorgfältigem Lösen des Kits wurden 5 µl mit 32P radioaktiv markiertem dCTP zugefügt und der Reaktionsansatz für 15 min bei 37 °C inkubiert. Die verbleibenden Einzelnukleotide wurden über eine Minisephadexsäule abgetrennt und die gereinigte Sonde erneut bei 95 °C für 15 min denaturiert.

 

Die zu hybridisierende Membran wurde für 20 min in 50 ml Hybridisierungslösung bei 65 °C im Schüttelwasserbad prähybridisiert. Die Prähybridisierungslösung wurde verworfen und erneut 50 ml Hybridisierungslösung zusammen mit der denaturierten Sonde zu der Membran zugegeben. Die Membran wurde für 16 h bei 65° C im Schüttelwasserbad hybridisiert. Die Hybridisierungslösung wurde in ein Falcontube überführt und für weitere Untersuchungen bei –80 °C gelagert. Anschließend wurde die Membran je 2 mal in Wash I und Wash II für je 20 min bei 65 °C im Schüttelwasserbad gewaschen. Die gewaschene Membran wurde in Folie eingeschweißt und auf einen Kodak X-Omat Film aufgebracht. Der Film wurde für 0,5 bis 12 h bei –80 °C belichtet. Anschließend wurde der Film in einem Crurix 2425 Entwickler von Agfa Geavert entwickelt.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.12     DNA-Sequenzierung

 

Referenzen:      Sanger et al., 1977; Herstellerangaben

 

Lösungen:        plusone Repel-Silane ES

plusone Bind-Silane

Rotiphores Sequenziergel Konzentrat

Rotiphores Sequenziergel Puffer

Rotiphores Sequenziergel Verdünner

TEMED

10 % Ammoniumpersulfat

TBE-Puffer:     90 mM Tris

90 mM Borsäure

2,5 mM EDTA, pH 8,0

0,4 M NaOH

0,4 M EDTA

3 M NaAcetat

96 % Ethanol

Oligonukleotidlösungen (10 pmol/ml)

T7 sequenase reaction Puffer

Termination Mix (ddATP, ddCTP, ddGTP, ddTTP)

Labeling Mix

0,1 M DTT

 

 

Vor dem Ansetzen der Sequenasereaktion wurde das Sequenziergel vorbereitet. Die Scheiben der Gelkammern wurden abgeseift und mit Ethanol gereinigt. Anschließend wurde die größere Scheibe mit etwas Repel-Silane und die kleinere Scheibe mit 200 µl Bind-Silane beschichtet. Die Scheiben wurden getrennt getrocknet und anschließend von zwei Spacern getrennt aufeinander gelegt und mit Metallklemmen fixiert. In einen Erlenmeyerkolben mit Absaugstutzen wurden 49,5 ml Gel-Verdünner, 18 ml Gel-Konzentrat und 7,5 ml Gel-Puffer gegeben und das Gemisch für 30 min an der Wasserstrahlpumpe entgast. Zu dem Gemisch wurden 800 µl 10 % APS und 100 µl TEMED pipettiert. Das Reaktionsgemisch wurde zügig und blasenfrei in die Gießkammer pipettiert und der Platzhalter für den Haifischkamm eingeschoben. Nach dem Aushärten wurde das Gel in die Gelkammer gebracht. Nach Füllen der Pufferkammer mit TBE-Puffer wurde der Platzhalter entfernt und die im Gel verbliebene Tasche mit einer Spritze gründlich gespült. Der Haifischkamm wurde vorsichtig in die Geltasche eingebracht und das Gel anschließend bei 40 W warmlaufen gelassen.

 

Das DNA Pellet einer Plasmidpräparation, wie in Kapitel 2.2.3 beschrieben, wurde in 20 µl 0,4 M NaOH und 20 µl 0,4 mM EDTA gelöst und 5 min bei Raumtemperatur zum Denaturieren der DNA stehen gelassen. Nach Zugabe von 4 µl 3 M NaAcetat wurde die DNA erneut mit 100 µl 96 % Ethanol bei -20 °C über Nacht gefällt. Die DNA wurde für 30 min mit 12000 rpm bei 4 °C pelletiert. Zu dem Pellet wurde 2 µl T7 sequenase reaction buffer, 1µl Oligonukleotid und 7 µl Aqua bidest. zupipetiert. Nach dem Lösen der DNA wurde diese, zur Oligonukleotid-Anlagerung für 5 min im Wasserbad auf 65 °C erhitzt und anschließend langsam für ca. 30 min auf Raumtemperatur abgekühlt. Nach kurzem Zentrifugieren wurde die Probe bis zur weiteren Verarbeitung auf Eis aufbewahrt.

 

In eine Microtiterplatte wurden in vier Vertiefungen je 2,5 µl jedes Termination Mix in der Reihenfolge A, C, G und T pipettiert und auf Eis gestellt. Der Labeling Mix wurde 5fach vorverdünnt. Zu der eisgekühlten Probe wurde dann 1 µl 0,1 M DTT, 2 µl verdünnter Labeling Mix, 0,5 µl dATP und 2µl verdünnte T7 Sequenase polymerase zupipettiert und für 2 bis 5 min bei Raumtemperatur inkubiert. Je 3,5 µl des Reaktionsgemisches wurden dann in die Microtiterplatte zu den vier Portionen Termination Mix pipettiert und für weitere 10 min bei 37 °C im Wasserbad inkubiert. Nach Zugabe von je 3,3 µl Stopmix zu jedem Reaktionsansatz wurden die Geltaschen mit 3,5 µl in der Reihenfolge A, C, G und T beschickt. Das Gel wurde bei 70 W für 30 min einlaufen gelassen und anschließend 2,5 h bei 90 W weitergefahren. 30 min vor Ende der gesamten Trennzeit wurde in die untere Pufferkammer 100 ml 3 M NaAcetat zugegeben. Nach vollständiger Auftrennung wurden die Glasscheiben vorsichtig getrennt und die kleinere Scheibe zur Entfernung des Harnstoffs mit dem anhaftenden Gel für 20 min in 10 % Essigsäure eingelegt. Anschließend wurde das Gel auf der Glasscheibe für 2 h bei 80 °C im Trockenschrank getrocknet. Das trockene Gel wurde in Zellophanfolie eingeschlagen und für 14 bis 16 h auf AGFA-Röntgenfilm aufgebracht, der dann in einem Crurix 2425 Entwickler von Agfa Geavert entwickelt wurde.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.13     Automatische DNA-Sequenzierung

 

Lösungen:        Termination Ready Reaction Mix

Template supression reagents

Oligonukleotidlösungen (10 pmol/ml)

 

Die automatische Sequenzierung wurde mit dem ABI PRISM®dGTP BigDye Terminator Ready Reaction Kit mit anschließender Kapillarelektrophorese durchgeführt. 200-500 ng Plasmid-DNA wurden in einem 0,5 ml PCR-Hütchen mit 8,0 µl Termination Ready Reaction Mix und 3,2 pmol des Oligonukleotids gemischt. Der Reaktionsansatz wurde auf ein Gesamtvolumen von 20 µl mit deionisiertem Wasser aufgefüllt und mit 40 µl mineralöl überschichtet. Die Probe wurde in einem MWG Biotech Thermocycler Primus 96 plus amplifiziert. Nach einer fünfminütigen Denaturierung bei 96 °C wurde 25 Zyklen mit je 10 s Denaturierungszeit (96 °C), 5 s Oligonukleotid-Anlagerung (45 °C) und 4 min Reaktionszeit (60 °C) durchgeführt. Die Probe wurde über eine Centri-Sep-Säule aufgereinigt. 5 µl der gereinigte Probe wurden zu 25 µl Template suppression reagents gegeben und durch Kapillarelektrophorese in dem ABI Prism 310 analysiert. Die erhaltenen Sequenzdaten wurden zur weiteren Verarbeitung auf den Genius-server des Deutschen Krebsforschungszentrums in Heidelberg gespielt.

 

Kapitelanfang Einen Absatz zurück Ein Kapitel zurück Ein Kapitel vor Einen Absatz vor Kapitelende

2.2.14     Polymerasekettenreaktion

 

Lösungen:        DyNAzyme DNA-Polymerase

dNTP Mix

Mg2+ free DyNAzyme buffer

50 mM Mg2+

 

Es wurden für jeden Reaktionsansatz 1,5 µl 50 mM Mg2+-Lösung, 1 µl dNTP Mix, 5 µl DyNAzyme buffer, 0,5 µl DNA-Polymerase und je 10 pmol der jeweiligen Oligonukleotide gemischt und mit Aqua bidest. auf 45 µl Gesamtvolumen aufgefüllt. Der Reaktionsansatz wurde mit 40 µl Mineralöl überschichtet. Es wurden 25-100 ng chromosomaler DNA in einem Volumen von 5 µl zu dem Reaktionsansatz pipettiert. Die Proben wurden in einem Perkin-Elmer Thermocycler amplifiziert. Nach 5 min Deanturierung bei 95 °C wurde 35 Zyklen mit je 30 s Denaturierungszeit (95 °C), 30 s Oligonukleotid-annealing (55 °C) und 45 s Reaktionszeit (72 °C) durchgeführt. Nach der Amplifikation wurden 10 µl der Probe in einem 2 % NuSieve-Agarosegel aufgetrennt.

 

 

 

 

 

Ein Kapitel zurück Ein Kapitel vor