Volltextdatei(en) vorhanden
DC ElementWertSprache
dc.contributor.advisorMeier, Chris (Prof. Dr.)
dc.contributor.authorBöge, Nicolas
dc.date.accessioned2020-10-19T12:21:24Z-
dc.date.available2020-10-19T12:21:24Z-
dc.date.issued2008
dc.identifier.urihttps://ediss.sub.uni-hamburg.de/handle/ediss/2052-
dc.description.abstractPolycyclische aromatische Amine gehören im Gegensatz zu monocyclischen aromatischen Aminen zur Klasse der starken Carcinogene. Die monocyclischen Amine wirken als Grenzcarcinogene. Bislang ist keine Erklärung für diesen Unterschied gefunden worden. Beide Klassen bilden kovalent gebundene Addukte mit der DNS. Wenn diese Schäden nicht repariert werden kann es bei der Replikation der DNS zu Mutationen und im schlimmsten Fall zu Krebs kommen. Um den mutagenen Effekt, die Struktur und die Reparatur solcher Addukte untersuchen zu können ist es notwendig Strategien zum gezielten Einbau der 2‘-dG-Addukte in Oligonucleotide zu entwickeln. Im ersten Teil dieser Arbeit wird die Synthese der Arylamin-modifizierten Phosphoramidite beschrieben. Dabei wurde zunächst die Optimierung der Synthese C8-Arylamin-modifizierter Addukte vorgenommen. Die Einführung einer stark basenlabilen Schutzgruppe für die exocyclische Aminofunktion des 2‘-dG sollte dabei die Abspaltungszeit im alkalischen Medium nach der Oligonucleotidsynthese verkürzen und eine höhere Ausbeute an modifiziertem Oligonucleotid zur Folge haben. Der Schlüsselschritt dieser Syntheseroute war eine Palladium-katalysierte Buchwald-Hartwig-Reaktion. Nach der vollständigen Entschützung der C8-Addukte konnte die exocyclische Aminofunktion mit Formamidin blockiert werden und diese Verbindungen anschließend in die für die Oligonucleotidsynthese benötigten Phosphoramidite überführt werden. Im zweiten Teil der Arbeit gelang es eine Syntheseroute zur Darstellung der N2-Arylamin-Addukte zu entwickeln. Auch in diesem Fall wurde auf eine Palladium-katalysierte Kreuzkupplung mit einem Bromid und den entsprechenden Arylhydrazinen zurückgegriffen um die N2-Modifikation einzuführen. Während der anschließenden Entschützung kam es zu einer teilweisen Oxidation zu den Azo-Produkten. Die Mischung dieser beiden Adduktformen (N2-Hydrazinoaryl und N2-Azoaryl) konnte getrennt werden und diese separat in die jeweiligen Phosphoramidite überführt werden. Hierfür war eine Blockierung der O6-Position mit einer Schutzgruppe (CPE) notwendig, welche nach der Oligonucleotidsynthese abgespalten werden kann, um eine Stabilisierung des Systems zu erreichen und eine Isolierung der Bausteine für die Oligonucleotidsynthese möglich zu ermöglichen. Als eine dritte Klasse von Addukten sollten die O6-Arylamin-Addukte des 2‘-dG synthetisiert werden. Dieses gelang jedoch weder mittels einer Mitsunobu- noch mittels einer Substitutionsreaktion. Bei der Blockierung der O6-Position mit Benzotriazol konnte eine rasche und effiziente Umsetzung zu dem unerwarteten Produkt, dem C8-N-Ac-Addukt, beobachtet werden. In weiteren vier Schritten gelang die Überführung in das entsprechende Phosphoramidit und damit die Entwicklung einer neuen, kurzen und höchst effizienten Syntheseroute für diese Art von Arylamin-Addukten. Die C8- und N2-modifizierten Phosphoramidite wurden in drei verschiedene Oligonucleotidsequenzen eingebaut. Erstens in die NarI-Sequenz mit einer Modifikation in Position 4 oder 7 5'-d(CTCGGCGCCATC), zweitens in eine selbstkomplementäre Sequenz, welche die Schnittstelle für das Enzym EcoRI besitzt 5'-d(GTAGAATTCTAC). Mittels dieser Oligonucleotide wurde der Effekt solcher Modifikationen auf die Hybridisierung und die Struktur der DNS-Doppelstränge untersucht. Die Ergebnisse der Tm-Wert und CD-Messungen ergaben keinen Unterschied in der Struktur der modifizierten Oligonucleotide. Es könnte jedoch ein größeres Absenken des Tm-Wertes für die polycyclischen Modifikationen beobachtet werden. Ebenso konnte gezeigt werden, dass N2-Modifikationen im Allgemeinen einen höheren Einfluss auf den Tm-Wert haben, als die C8-Addukte. Mit den selbstkomplementären 12meren konnte ein Restriktionsverdau mit EcoRI etabliert werden. Hierbei konnte festgestellt werden, dass eine Modifikation an der Schnittstelle zu einer kompletten Inaktivierung des Enzyms führt. Auch eine Modifikation außerhalb der Schnittstelle führte zu einer höheren Halbwertszeit, wobei der Effekt für einen monocyclischen DNS-Schaden größer war als der einer polycyclischen Modifikation. Um den Effekt der C8-Arylamin-Addukte auf die Effektivität von DNS-Polymerasen untersuchen zu können wurde folgende Sequenz synthetisiert 5'-d(AAATG*AACCTATCCTCCTTCAGGACCAACG) und als Templat in Primer-Verlängerungsuntersuchungen mit drei verschiedenen Polymerasen (Pfu, Pol beta und Dpo4) verwendet. Hierbei konnten Unterschiede in Abhängigkeit von der Modifikation als auch der verwendeten Polymerase gemacht werden. Das auffälligste Resultat ist, dass ein monocyclischer DNS-Schaden eine höhere Rate für einen nicht-kanonischen Einbau gegenüber der Modifikation hervorruft, als dieses für eine polycyclische Modifikation zu beobachten ist. Um Informationen über die Struktur modifizierter Oligonucleotide zu erhalten wurden erste Experimente zur Kristallisation der selbst-komplementären Oligonucleotide vorgenommen.de
dc.description.abstractPolycyclic aromatic amines belong to the class of strong chemical carcinogens, whereas monocyclic aromatic amines are only borderline carcinogens. Until now no reason for their different carcinogenic potential was found. Both types form covalently bonded adducts with DNA after metabolic activation. If these damages are not repaired, they can compromise the fidelity of DNA replication and cause mutations and possibly cancer. To properly study the mutagenic effects, structure and repair of these adducts, it was the aim of this thesis, to develop strategies for the site-specific incorporation of these dG-carcinogen-adducts into oligonucleotides. The first section of this thesis deals with the synthesis of the arylamine-modified phosphoramidites. Primary goal was to achieve an optimization of the synthesis of C8-arylamine-adducts using a base labile protecting group for the exocyclic amino function of 2’-dG to shorten the period of time for the alkaline cleavage after oligonucleotide synthesis. The key step for this synthesis was the Pd-catalyzed Buchwald-Hartwig reaction. After the complete deprotection of these adducts the formamidine group was introduced to block the exocyclic amino function. After that the compounds were converted into the corresponding oligonucleotide building blocks by dimethoxytritylation and phosphitylation. In the second part of this thesis a synthetic route to the N2-arylamine-adducts was found. Again a Pd-catalyzed cross-coupling reaction with the bromide and the corresponding arylhydrazines was used to introduce the N2-modification. During the subsequently performed deprotection a partial oxidation to the corresponding azo-products could be observed. The mixture of the two N2-adduct forms (N2-hydrazinoaryl and N2-azoaryl) could be separated using RP column chromatography. Afterwards a dimethoxytritylation and phosphitylation led to the desired N2-arylamine modified phosphoramidites. Therefore a blocking of the O6-position using a protecting group which could be cleaved after oligonucleotide synthesis (Pfleiderers CPE-group) was found to be essential to stabilize the system and for the isolation of these oligonucleotide building blocks. As a third class of adducts the O6-arylamine modified 2’-dG-derivatives were target molecules. Unfortunately, the modifications could be introduced neither by a Mitsunobu-reaction nor by a substitution using different protected hydroxylamines. When using the O6-benzotriazol protected 2’-dG-derivative a quick and highly efficient conversion to the unexpected product, the C8-N-Ac-adduct, was observed. In four additional synthetic steps a conversion into the corresponding phosphoramidite with an overall yield of 20% was achieved and therewith a new and short synthesis for this type of adduct been developed. The C8- and N2-modified phosphoramidites were incorporated into three different oligonucleotide sequences. First the NarI-sequence with a modification in position 4 or 7 5'-d(CTCGGCGCCATC), and a self complementary sequence with a recognition site for then EcoRI enzyme 5'-d(GTAGAATTCTAC) were used to investigate the effects of the modification on hybridisation and structure of the resulting DNA-helices. The result of these CD- and Tm value studies were that no difference in structure was observed, but a higher decrease of the polycyclic modifications of the Tm-value. Also the influence of the N2-modifications compared to the corresponding C8-adducts was bigger and for these modified oligonucleotides a lower Tm-value was measured. Using the oligonucleotides of the EcoRI-sequence a restriction assay was performed. As a result, a total prevention was achieved by modifying the dG-nucleotide at the cleavage site. When the modification was outside the recognition sequence a higher influence, leading to a higher half-live, for the C8-monocyclic-adducted oligonucleotides than for the polycyclic-modified one was observed. To study the influence of C8-arylamine adducts on the effectiveness of DNA-polymerases, oligonucleotides of the following sequence were synthesized 5'-d(AAATG*AACCTATCCTCCTTCAGGACCAACG) and used as templates in primer-extension experiments. Three different polymerases were used, Pfu, Pol beta and Dpo4. The primer-extension experiments with the modified oligonucleotides revealed differences between the three polymerases and between the modifications. The most outstanding result is that there is a much more significant introduction of a wrong base for the monocyclic modifications (dGTP and dATP instead of dCTP) opposite the modified base. This effect was also observed for the strong-carcinogen adducts, but was in comparison only very small. To gain information about the structure of the modified oligonucleotides first experiments for the crystallization of the unmodified self-complementary oligonucleotide were performed.en
dc.language.isodede
dc.publisherStaats- und Universitätsbibliothek Hamburg Carl von Ossietzky
dc.rightshttp://purl.org/coar/access_right/c_abf2
dc.subjectDNA-Schädende
dc.subject.ddc540 Chemie
dc.titleSynthese von Arylamin-modifizierten 2’-dG-Phosphoramiditen und deren Einbau in Oligonucleotidede
dc.typedoctoralThesis
dcterms.dateAccepted2008-03-14
dc.rights.ccNo license
dc.rights.rshttp://rightsstatements.org/vocab/InC/1.0/
dc.subject.bcl35.50 Organische Chemie: Allgemeines
dc.subject.bcl35.52 Präparative Organische Chemie
dc.subject.gndArylamine
dc.subject.gndCarcinogenese
dc.type.casraiDissertation-
dc.type.dinidoctoralThesis-
dc.type.driverdoctoralThesis-
dc.type.statusinfo:eu-repo/semantics/publishedVersion
dc.type.thesisdoctoralThesis
tuhh.opus.id3620
tuhh.opus.datecreation2008-03-26
tuhh.type.opusDissertation-
thesis.grantor.departmentChemie
thesis.grantor.placeHamburg
thesis.grantor.universityOrInstitutionUniversität Hamburg
dcterms.DCMITypeText-
tuhh.gvk.ppn578825872
dc.identifier.urnurn:nbn:de:gbv:18-36202
item.creatorGNDBöge, Nicolas-
item.fulltextWith Fulltext-
item.advisorGNDMeier, Chris (Prof. Dr.)-
item.languageiso639-1other-
item.creatorOrcidBöge, Nicolas-
item.grantfulltextopen-
Enthalten in den Sammlungen:Elektronische Dissertationen und Habilitationen
Dateien zu dieser Ressource:
Datei Beschreibung Prüfsumme GrößeFormat  
Dissertation_Nicolas_Boege.pdfd24cc285d0ae82fd001d9c107dfacf8b5.56 MBAdobe PDFMiniaturbild
Öffnen/Anzeigen
Zur Kurzanzeige

Diese Publikation steht in elektronischer Form im Internet bereit und kann gelesen werden. Über den freien Zugang hinaus wurden durch die Urheberin / den Urheber keine weiteren Rechte eingeräumt. Nutzungshandlungen (wie zum Beispiel der Download, das Bearbeiten, das Weiterverbreiten) sind daher nur im Rahmen der gesetzlichen Erlaubnisse des Urheberrechtsgesetzes (UrhG) erlaubt. Dies gilt für die Publikation sowie für ihre einzelnen Bestandteile, soweit nichts Anderes ausgewiesen ist.

Info

Seitenansichten

741
Letzte Woche
Letzten Monat
geprüft am 10.02.2026

Download(s)

362
Letzte Woche
Letzten Monat
geprüft am 10.02.2026
Werkzeuge

Google ScholarTM

Prüfe